video4all video4all

04-03-2021
Biology

contestada

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Respuesta :

addysenseheult addysenseheult

04-03-2021

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

Answer Link

Otras preguntas

The chart shows the speed at which light travels through different media. In which medium would light have the longest wavelength? - Water - Air - Glass - Diamo

To determine the organic material in a dried lake bed, the percent carbon by mass is measured at two different locations. To compare the means of the two differ

Write an algebraic expression for the situation. 28 divided by a number n An algebraic expression for the situation is

what is the term used to describe the situation when a derieved class provides a function already provided in the bae class

write a story which end with the sentence "we were luck that night"

A(n) on bonds payable occurs when a company issues bonds with a contract rate less than the market rate.

A 5-year treasury bond with a coupon rate of 8% (paid semiannually) has a face value of $1,000. What is the semiannual coupon payment

If you take a certain number and write a 9 to the right of it and add the doubled certain number to the result, the sum will be equal to 633. Find the certain n

Calculate the sum of the integers from 52 to 108

When your vehicle turns a corner, the tracks made by the rear tires are always: a) Outside of those made by your front tires b) Inside of those made by your fro